Review

control scrambled shrna lentivirus (OriGene)

OriGene is a verified supplier

OriGene manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

OriGene control scrambled shrna lentivirus
Control Scrambled Shrna Lentivirus, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+shrnas/bio_rxiv__64898__2026__05__07__723592-192-12-17?v=OriGene
Average 95 stars, based on 134 article reviews

control scrambled shrna lentivirus - by Bioz Stars, 2026-08

95/100 stars

Images

Image Search Results

TCF7 regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, shRNA, shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).

Journal: International Journal of Molecular Sciences

Article Title: Unfolding Immune Dysregulation in COPD: Identification of a Three-Gene Signature and Functional Validation of TCF7 in Human Lung Tissue and T Lymphocytes

doi: 10.3390/ijms27104231

Figure Lengend Snippet: TCF7 regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, shRNA, shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).

Article Snippet: Short hairpin RNA targeting human TCF7 (shRNA) and a scramble control shRNA were purchased from OriGene with Cat.No.TR30004.

Techniques: Expressing, Immunofluorescence, Staining, Control, Western Blot, Knock-Out, Isolation, shRNA, Construct, Plasmid Preparation

A) FOXO1 mRNA expression was analyzed by RT-qPCR in BEAS-2B cells transduced with FOXO1 shRNA or scrambled shRNA (n = 8). B) Representative Western blot and C) densitometry quantification (n = 6) of FOXO1 protein levels in cells treated with FOXO1 shRNA lentivirus, scrambled shRNA lentivirus and untransduced cells (control). Statistical analysis with t-test *p < 0.05, **p < 0.01. FOXO3 (D) and FOXO4 (E) expression levels in FOXO1 shRNA and scrambled shRNA lentivirus transfected cells were assessed by RT-qPCR (n = 5). Mean fluorescence intensity of FOXO1 localized to the nucleus (F) and whole cell expression (G) was quantified with Volocity software. For each group 40-60 cells per slide were analyzed. Statistical Analysis was performed using Anova **P < 0.01, **** P < 0.0001 H) Immunofluorescence staining for FOXO1 in BEAS-2B cells transduced with FOXO1 shRNA or scrambled shRNA. FOXO1 (red) was detected using an anti-FOXO1 monoclonal antibody, nuclei were stained with DAPI (blue), and the cytoskeleton was visualized with phalloidin (green). Images were captured at 60 × magnification using a DeltaVision Confocal Microscope.

Journal: PLOS One

Article Title: FOXO1 transcription factor modulates airway epithelial responses to viral infection

doi: 10.1371/journal.pone.0345169

Figure Lengend Snippet: A) FOXO1 mRNA expression was analyzed by RT-qPCR in BEAS-2B cells transduced with FOXO1 shRNA or scrambled shRNA (n = 8). B) Representative Western blot and C) densitometry quantification (n = 6) of FOXO1 protein levels in cells treated with FOXO1 shRNA lentivirus, scrambled shRNA lentivirus and untransduced cells (control). Statistical analysis with t-test *p < 0.05, **p < 0.01. FOXO3 (D) and FOXO4 (E) expression levels in FOXO1 shRNA and scrambled shRNA lentivirus transfected cells were assessed by RT-qPCR (n = 5). Mean fluorescence intensity of FOXO1 localized to the nucleus (F) and whole cell expression (G) was quantified with Volocity software. For each group 40-60 cells per slide were analyzed. Statistical Analysis was performed using Anova **P < 0.01, **** P < 0.0001 H) Immunofluorescence staining for FOXO1 in BEAS-2B cells transduced with FOXO1 shRNA or scrambled shRNA. FOXO1 (red) was detected using an anti-FOXO1 monoclonal antibody, nuclei were stained with DAPI (blue), and the cytoskeleton was visualized with phalloidin (green). Images were captured at 60 × magnification using a DeltaVision Confocal Microscope.

Article Snippet: As a negative control, a lentivirus expressing scrambled shRNA, which does not target any mammalian gene, was used to transduce BEAS-2B cells (scrambled shRNA) (Addgene #1864).

Techniques: Expressing, Quantitative RT-PCR, Transduction, shRNA, Western Blot, Control, Transfection, Fluorescence, Software, Immunofluorescence, Staining, Microscopy

WST-1 proliferation assay (A) and total cell counts (B) for 5 days following plating of BEAS-2B cells treated with FOXO1 shRNA lentivirus, scrambled shRNA lentivirus and untransduced cells (control) (n = 3). Representative flow cytometry plot (D) and percent of dead (C) and apoptotic (E) BEAS-2B cells analyzed with Annexin V and PI dye (n = 3). Statistical Analysis was performed with ANOVA. F) BEAS-2B monolayer average resistance tracings at 4000 Hz in response to wounding challenge measured with ECIS1600; n = 4 cell replicates per group. Quantification of resistance after wounding (G) and at the end-point (H) shows a significant difference between scrambled shRNA and FOXO1 deficient BEAS-2B cells. Statistical Analysis with t-test* p < 0.05.

Journal: PLOS One

Article Title: FOXO1 transcription factor modulates airway epithelial responses to viral infection

doi: 10.1371/journal.pone.0345169

Figure Lengend Snippet: WST-1 proliferation assay (A) and total cell counts (B) for 5 days following plating of BEAS-2B cells treated with FOXO1 shRNA lentivirus, scrambled shRNA lentivirus and untransduced cells (control) (n = 3). Representative flow cytometry plot (D) and percent of dead (C) and apoptotic (E) BEAS-2B cells analyzed with Annexin V and PI dye (n = 3). Statistical Analysis was performed with ANOVA. F) BEAS-2B monolayer average resistance tracings at 4000 Hz in response to wounding challenge measured with ECIS1600; n = 4 cell replicates per group. Quantification of resistance after wounding (G) and at the end-point (H) shows a significant difference between scrambled shRNA and FOXO1 deficient BEAS-2B cells. Statistical Analysis with t-test* p < 0.05.

Article Snippet: As a negative control, a lentivirus expressing scrambled shRNA, which does not target any mammalian gene, was used to transduce BEAS-2B cells (scrambled shRNA) (Addgene #1864).

Techniques: Proliferation Assay, shRNA, Control, Flow Cytometry

A) TLR3 mRNA expression was assessed by RT-qPCR in BEAS-2B cells transduced with FOXO1 shRNA or scrambled shRNA lentivirus. Expression levels were normalized to housekeeping gene GAPDH and expressed relative to untransduced cells (n = 12). Statistical analysis was performed with t-test ****p < 0.0001. B) TLR4 mRNA expression was analyzed by RT-qPCR in BEAS-2B cells transduced with FOXO1 shRNA and scrambled shRNA lentivirus. Expression was normalized to GAPDH and expressed relative to untransduced cells (n = 4). Statistical analysis with t-test. Representative Western blot (C) and densitometry analysis (D) of TLR3 expression for FOXO1 deficient BEAS-2B cells compared to controls, B-actin was used as a loading control (n = 6). Statistical Analysis with t-test, **p < 0.01. FOXO1 deficient cells and scrambled shRNA cells were stimulated with 50 µg/mL Poly(I:C) for 24 hours and release of IL6 (E),CCL2 (F), GM-CSF (G), IFN-λ (H), CXCL10 (I), IL8 (J), TNF-α (K), and TSLP (L) was tested with an MSD assay (n = 3). TLR3 mRNA expression was assessed by RT-qPCR in BEAS-2B (M) and NHBE (N) cells stimulated with Poly(I:C) for 8 hours in the presence or absence of the FOXO1 inhibitor AS1842856 (1 µM) (n = 5). Statistical analysis was performed using ANOVA *p < 0.05. **p < 0.01, **** P < 0.0001.

Journal: PLOS One

Article Title: FOXO1 transcription factor modulates airway epithelial responses to viral infection

doi: 10.1371/journal.pone.0345169

Figure Lengend Snippet: A) TLR3 mRNA expression was assessed by RT-qPCR in BEAS-2B cells transduced with FOXO1 shRNA or scrambled shRNA lentivirus. Expression levels were normalized to housekeeping gene GAPDH and expressed relative to untransduced cells (n = 12). Statistical analysis was performed with t-test ****p < 0.0001. B) TLR4 mRNA expression was analyzed by RT-qPCR in BEAS-2B cells transduced with FOXO1 shRNA and scrambled shRNA lentivirus. Expression was normalized to GAPDH and expressed relative to untransduced cells (n = 4). Statistical analysis with t-test. Representative Western blot (C) and densitometry analysis (D) of TLR3 expression for FOXO1 deficient BEAS-2B cells compared to controls, B-actin was used as a loading control (n = 6). Statistical Analysis with t-test, **p < 0.01. FOXO1 deficient cells and scrambled shRNA cells were stimulated with 50 µg/mL Poly(I:C) for 24 hours and release of IL6 (E),CCL2 (F), GM-CSF (G), IFN-λ (H), CXCL10 (I), IL8 (J), TNF-α (K), and TSLP (L) was tested with an MSD assay (n = 3). TLR3 mRNA expression was assessed by RT-qPCR in BEAS-2B (M) and NHBE (N) cells stimulated with Poly(I:C) for 8 hours in the presence or absence of the FOXO1 inhibitor AS1842856 (1 µM) (n = 5). Statistical analysis was performed using ANOVA *p < 0.05. **p < 0.01, **** P < 0.0001.

Article Snippet: As a negative control, a lentivirus expressing scrambled shRNA, which does not target any mammalian gene, was used to transduce BEAS-2B cells (scrambled shRNA) (Addgene #1864).

Techniques: Expressing, Quantitative RT-PCR, Transduction, shRNA, Western Blot, Control

A) RT-qPCR showed increased TLR3 mRNA expression for BEAS-2B transfected with a CA-FOXO1 plasmid compared to vector control (cells transfected with an empty plasmid); GAPDH was used as a housekeeping gene (n = 6). Representative Western blot (B) and densitometry analysis (C) of TLR3 expression for BEAS-2B transfected with CA-FOXO1 plasmid compared to vector control, β-actin was used as a loading control (n = 6). Statistical Analysis with t-test, **p < 0.01. D + E) Immunofluorescence staining for BEAS-2B transduced with CA-FOXO1 shows increased FOXO1 protein in the nucleus. FOXO1 (red) was detected using an anti-FOXO1 antibody with a red-fluorescent secondary antibody, F-actin (green) with phalloidin, and nuclei (blue) with DAPI. Images were taken with an Olympus IX81 epifluorescence microscope using a 20X objective lens. Volocity Analysis was used to quantify nuclear localization of FOXO1 by measuring the mean fluorescence intensity of FOXO1 staining colocalized with DAPI. For each group 40−60 cells per slide were analyzed. Statistical Analysis was conducted with ANOVA **** p < 0.001. BEAS-2B cells transduced with FOXO1 or scrambled shRNA lentivirus were analyzed by RT-qPCR for DDX58 (RIG-I, F), MAVS (G), and MYD88 (H) mRNA expression at baseline and after Poly(I:C) stimulation (8 h and 24 h). Expression was normalized to GAPDH and expressed relative to unstimulated scrambled controls (n = 3; ANOVA). (I) NHBE cells were infected with SARS-CoV-2 in the presence or absence of a FOXO1 inhibitor. Total RNA was collected 24 h post-infection, and viral RNA levels were quantified by qRT-PCR, normalized to ACTB, and expressed relative to mock-infected cells (n = 3; paired t-test).

Journal: PLOS One

Article Title: FOXO1 transcription factor modulates airway epithelial responses to viral infection

doi: 10.1371/journal.pone.0345169

Figure Lengend Snippet: A) RT-qPCR showed increased TLR3 mRNA expression for BEAS-2B transfected with a CA-FOXO1 plasmid compared to vector control (cells transfected with an empty plasmid); GAPDH was used as a housekeeping gene (n = 6). Representative Western blot (B) and densitometry analysis (C) of TLR3 expression for BEAS-2B transfected with CA-FOXO1 plasmid compared to vector control, β-actin was used as a loading control (n = 6). Statistical Analysis with t-test, **p < 0.01. D + E) Immunofluorescence staining for BEAS-2B transduced with CA-FOXO1 shows increased FOXO1 protein in the nucleus. FOXO1 (red) was detected using an anti-FOXO1 antibody with a red-fluorescent secondary antibody, F-actin (green) with phalloidin, and nuclei (blue) with DAPI. Images were taken with an Olympus IX81 epifluorescence microscope using a 20X objective lens. Volocity Analysis was used to quantify nuclear localization of FOXO1 by measuring the mean fluorescence intensity of FOXO1 staining colocalized with DAPI. For each group 40−60 cells per slide were analyzed. Statistical Analysis was conducted with ANOVA **** p < 0.001. BEAS-2B cells transduced with FOXO1 or scrambled shRNA lentivirus were analyzed by RT-qPCR for DDX58 (RIG-I, F), MAVS (G), and MYD88 (H) mRNA expression at baseline and after Poly(I:C) stimulation (8 h and 24 h). Expression was normalized to GAPDH and expressed relative to unstimulated scrambled controls (n = 3; ANOVA). (I) NHBE cells were infected with SARS-CoV-2 in the presence or absence of a FOXO1 inhibitor. Total RNA was collected 24 h post-infection, and viral RNA levels were quantified by qRT-PCR, normalized to ACTB, and expressed relative to mock-infected cells (n = 3; paired t-test).

Article Snippet: As a negative control, a lentivirus expressing scrambled shRNA, which does not target any mammalian gene, was used to transduce BEAS-2B cells (scrambled shRNA) (Addgene #1864).

Techniques: Quantitative RT-PCR, Expressing, Transfection, Plasmid Preparation, Control, Western Blot, Immunofluorescence, Staining, Transduction, Microscopy, Fluorescence, shRNA, Infection

A) Representative set of Immunofluorescence staining for BEAS-2B cells stimulated with 50 µg/mL Poly(I:C) at different time points. FOXO1 (red) was detected using an anti-FOXO1 monoclonal antibody, nuclei were stained with DAPI (blue), and the cytoskeleton was visualized with phalloidin (green). Images were captured at 60 × magnification using a DeltaVision Confocal Microscope. B) Mean fluorescence intensity of FOXO1 localized to the nucleus was quantified with Volocity software. For each group 40–60 cells were analyzed. Statistical Analysis was performed using Anova ***P < 0.001, **** P < 0.0001.

Journal: PLOS One

Article Title: FOXO1 transcription factor modulates airway epithelial responses to viral infection

doi: 10.1371/journal.pone.0345169

Figure Lengend Snippet: A) Representative set of Immunofluorescence staining for BEAS-2B cells stimulated with 50 µg/mL Poly(I:C) at different time points. FOXO1 (red) was detected using an anti-FOXO1 monoclonal antibody, nuclei were stained with DAPI (blue), and the cytoskeleton was visualized with phalloidin (green). Images were captured at 60 × magnification using a DeltaVision Confocal Microscope. B) Mean fluorescence intensity of FOXO1 localized to the nucleus was quantified with Volocity software. For each group 40–60 cells were analyzed. Statistical Analysis was performed using Anova ***P < 0.001, **** P < 0.0001.

Article Snippet: As a negative control, a lentivirus expressing scrambled shRNA, which does not target any mammalian gene, was used to transduce BEAS-2B cells (scrambled shRNA) (Addgene #1864).

Techniques: Immunofluorescence, Staining, Microscopy, Fluorescence, Software

A) The top panel presents FOXO1 ChIP-Seq peaks retrieved from Gene Expression Omnibus ( GSM3681486 ) in HUVEC cells and ( GSM5214707 ) in the HepG2 cell line. The bottom panel shows FOXO1 binding sites from the ChIP-Atlas visualized with IGV (Integrative Genomics Viewer). The FOXO1 motif from the HOCOMOCO database within the proximal promoter sequence of the TLR3 gene is highlighted below. B) EMSA with nuclear extracts from BEAS-2B cells incubated with FOXO1-TLR3 Promoter Oligos. Nuclear extracts from BEAS-2B cells transfected with CA-FOXO1 or plasmid control. Lane 1: dye only, Lane 2: probe only, Lane 3: nuclear extracts from CA-FOXO1 BEAS-2B cells, Lane 4: nuclear extracts from CA-FOXO1 BEAS-2B cells + cold competitor, Lane 5: nuclear extracts from vector control BEAS-2B cells, Lane 6: nuclear extracts from vector control BEAS-2B cells + cold competitor. Lane 3 shows complex I formation, which disappears in lane 4, indicating non-specific binding. C) Nuclear extracts of BEAS-2B cells transfected with CA-FOXO1 incubated with or without FOXO1 mAb shows the formation of complex I + II, but no supershift occurred. D) Incubation of protein extracts from BEAS-2B FOXO1 deficient and scrambled control lines show formation of complexes I and II but no difference is observed between cell lines.

Journal: PLOS One

Article Title: FOXO1 transcription factor modulates airway epithelial responses to viral infection

doi: 10.1371/journal.pone.0345169

Figure Lengend Snippet: A) The top panel presents FOXO1 ChIP-Seq peaks retrieved from Gene Expression Omnibus ( GSM3681486 ) in HUVEC cells and ( GSM5214707 ) in the HepG2 cell line. The bottom panel shows FOXO1 binding sites from the ChIP-Atlas visualized with IGV (Integrative Genomics Viewer). The FOXO1 motif from the HOCOMOCO database within the proximal promoter sequence of the TLR3 gene is highlighted below. B) EMSA with nuclear extracts from BEAS-2B cells incubated with FOXO1-TLR3 Promoter Oligos. Nuclear extracts from BEAS-2B cells transfected with CA-FOXO1 or plasmid control. Lane 1: dye only, Lane 2: probe only, Lane 3: nuclear extracts from CA-FOXO1 BEAS-2B cells, Lane 4: nuclear extracts from CA-FOXO1 BEAS-2B cells + cold competitor, Lane 5: nuclear extracts from vector control BEAS-2B cells, Lane 6: nuclear extracts from vector control BEAS-2B cells + cold competitor. Lane 3 shows complex I formation, which disappears in lane 4, indicating non-specific binding. C) Nuclear extracts of BEAS-2B cells transfected with CA-FOXO1 incubated with or without FOXO1 mAb shows the formation of complex I + II, but no supershift occurred. D) Incubation of protein extracts from BEAS-2B FOXO1 deficient and scrambled control lines show formation of complexes I and II but no difference is observed between cell lines.

Article Snippet: As a negative control, a lentivirus expressing scrambled shRNA, which does not target any mammalian gene, was used to transduce BEAS-2B cells (scrambled shRNA) (Addgene #1864).

Techniques: ChIP-sequencing, Gene Expression, Binding Assay, Sequencing, Incubation, Transfection, Plasmid Preparation, Control

( A ) Male mice were bilaterally injected in the dCA1 with AAV carrying specific short hairpin RNAs (shRNF10, orange) to silence endogenous RNF10 or scramble shRNA (Scr, light blue). Representative image of a coronal section of dCA1. ( B ) mRNA levels of endogenous RNF10 following injection with shRNA RNF10 or a scramble shRNA in the dCA1 (two-tailed unpaired t - test, p < 0.001, n = 4/5). ( C ) Performance in the object location test 2 and 24 h following the sample phase for Scr (n = 5) and ShRNF10 (n = 5) mice, expressed as the discrimination ratio (two-tailed unpaired t -test, 2 h: p = 0.0081, 24 h: p = 0.0004). ( D ) Schematic of the automated visual cue response discrimination and reversal test. ( E ) Number of trials (SD: two-tailed unpaired t -test, p = 0.8650; SDRe: two-tailed unpaired t -test, p = 0.0112), ( F ) Time (SD: two-tailed unpaired t -test, p = 0.6923; SDRe: two-tailed unpaired t -test, p = 0.0007), and ( G ) Latency to make a correct response (SD: two-tailed unpaired t -test, p = 0.8090; SDRe: two-tailed unpaired t -test, p = 0.050) required by Scr (n = 11) and ShRNF10 (n = 10) mice to complete the SD and SDRe. ( H ) Number of perseverant (two-tailed unpaired t -test, t = 2.53, df = 19, p = 0.020) and regressive (two-tailed unpaired t -test, p = 0.6690) errors made by Scr (n = 11) and ShRNF10 (n = 10) mice during the SDRe. ( I ) Freezing behavior (expressed in s) of Scr (n = 8) and ShRNF10 (n = 8) mice during baseline, conditioning (three-tone–shock pairings), and post-conditioning stages of the fear conditioning learning (two-way RM ANOVA, stage x group, F( 2,28 ) = 0.73, p = 0.4893). ( J ) Freezing behavior of Scr (n = 8) and ShRNF10 (n = 8) mice during memory recall 2 weeks following the conditioning in the conditioning chamber (context A, two-tailed unpaired t -test, p = 0.0268) or in ( K ) a modified chamber (context B, two-tailed unpaired t -test, p = 0.2474) or in ( L ) a modified chamber in the presence of the conditioned tone (two-tailed unpaired t -test, p = 0.9856). ( M ) Freezing behavior of Scr (n = 6) and ShRNF10 (n = 6) mice during the memory recall 4 weeks following conditioning (two-tailed unpaired t -test, p = 0.9587). *p < 0.05, **p < 0.01, ***p < 0.005. Values are expressed as means ± s.e.m.

Journal: bioRxiv

Article Title: Hippocampal Ring Finger Protein 10-dependent signaling supports cognitive flexibility

doi: 10.64898/2026.03.31.715507

Figure Lengend Snippet: ( A ) Male mice were bilaterally injected in the dCA1 with AAV carrying specific short hairpin RNAs (shRNF10, orange) to silence endogenous RNF10 or scramble shRNA (Scr, light blue). Representative image of a coronal section of dCA1. ( B ) mRNA levels of endogenous RNF10 following injection with shRNA RNF10 or a scramble shRNA in the dCA1 (two-tailed unpaired t - test, p < 0.001, n = 4/5). ( C ) Performance in the object location test 2 and 24 h following the sample phase for Scr (n = 5) and ShRNF10 (n = 5) mice, expressed as the discrimination ratio (two-tailed unpaired t -test, 2 h: p = 0.0081, 24 h: p = 0.0004). ( D ) Schematic of the automated visual cue response discrimination and reversal test. ( E ) Number of trials (SD: two-tailed unpaired t -test, p = 0.8650; SDRe: two-tailed unpaired t -test, p = 0.0112), ( F ) Time (SD: two-tailed unpaired t -test, p = 0.6923; SDRe: two-tailed unpaired t -test, p = 0.0007), and ( G ) Latency to make a correct response (SD: two-tailed unpaired t -test, p = 0.8090; SDRe: two-tailed unpaired t -test, p = 0.050) required by Scr (n = 11) and ShRNF10 (n = 10) mice to complete the SD and SDRe. ( H ) Number of perseverant (two-tailed unpaired t -test, t = 2.53, df = 19, p = 0.020) and regressive (two-tailed unpaired t -test, p = 0.6690) errors made by Scr (n = 11) and ShRNF10 (n = 10) mice during the SDRe. ( I ) Freezing behavior (expressed in s) of Scr (n = 8) and ShRNF10 (n = 8) mice during baseline, conditioning (three-tone–shock pairings), and post-conditioning stages of the fear conditioning learning (two-way RM ANOVA, stage x group, F( 2,28 ) = 0.73, p = 0.4893). ( J ) Freezing behavior of Scr (n = 8) and ShRNF10 (n = 8) mice during memory recall 2 weeks following the conditioning in the conditioning chamber (context A, two-tailed unpaired t -test, p = 0.0268) or in ( K ) a modified chamber (context B, two-tailed unpaired t -test, p = 0.2474) or in ( L ) a modified chamber in the presence of the conditioned tone (two-tailed unpaired t -test, p = 0.9856). ( M ) Freezing behavior of Scr (n = 6) and ShRNF10 (n = 6) mice during the memory recall 4 weeks following conditioning (two-tailed unpaired t -test, p = 0.9587). *p < 0.05, **p < 0.01, ***p < 0.005. Values are expressed as means ± s.e.m.

Article Snippet: For shRNA experiments, sequences for mouse RNF10 shRNA (mature antisense TCAGGTTGATCTTCTTAGGG) and scramble shRNA (purchased from Origene, Rockville, MD) were subcloned downstream of U6 in the U6-CamKIIa.mCherry-WPRE backbone (provided by Prof. Daniela Mauceri, University of Heidelberg, DE) using BamHI and HindIII restriction enzymes (New England Biolabs, USA).

Techniques: Injection, shRNA, Two Tailed Test, Modification

( A ) qRT-PCR analysis for the expression of endogenous RNF10 following injection with scramble shRNA (n=13), shRNF10 (n=13) or shRNF10 + ShResistant (n=10) in the mouse dCA1. Gene expression was normalized to TUBA1A (Brown–Forsythe ANOVA with Dunnett’s T3 multiple comparisons test. p≤0.0001). ( B ) Performance in the object location test 24 h following the sample phase for Scr (n = 14), ShRNF10 (n = 15) and ShRNF10 + ShResistant (n = 14) mice, expressed as the discrimination ratio (One-way ANOVA with Tukey’s post hoc test. Scr vs ShRNF10 p=0.0001; Scr vs Sh+ShResistant p=0.9078; ShRNF10 vs Sh+ShResistant p=0.0004) ( C ) Number of trials (Mixed-effects model with Fisher’s LSD multiple comparisons test. SD: Scr vs ShRNF10 p=0.5918; Scr vs Sh+ShResistant p=0.0656; ShRNF10 vs Sh+ShResistant p=0.1781; SDRe: Scr vs ShRNF10 p=0.0202; Scr vs Sh+ShResistant p=0.1125; ShRNF10 vs Sh+ShResistant p=0.7725) and ( D ) time (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance. SD: Scr vs ShRNF10 p=0.9953; Scr vs Sh+ShResistant p=0.0119; ShRNF10 vs Sh+ShResistant p=0.0130; SDRe: Scr vs ShRNF10 p=0.0456; Scr vs Sh+ShResistant p=0.2449; ShRNF10 vs Sh+ShResistant p=0.6527) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( E ) Latency to make a correct response (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance; SD: Scr vs ShRNF10 p=0.8420; Scr vs Sh+ShResistant p=0.1186; ShRNF10 vs Sh+ShResistant p=0.0855; SDRe: Scr vs ShRNF10 p=0.0543; Scr vs Sh+ShResistant p=0.7026; ShRNF10 vs Sh+ShResistant p=0.1701) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( F ) Number of perseverant and regressive errors made by Scr (n = 19), ShRNF10 (n = 18) and ShRNF10 + ShResistant (n = 13) mice during the SDRe (Kruskal–Wallis test with Dunn’s multiple comparisons test. Perseverant: Scr vs ShRNF10 p=0.0054; Scr vs Sh+ShResistant p>0.9999; ShRNF10 vs Sh+ShResistant p=0.0358; Regressive: Scr vs ShRNF10 p=0.0.6805; Scr vs Sh+ShResistant p=0.0016; ShRNF10 vs Sh+ShResistant p=0.0527). ( G ) Comparison of time required to complete the SD vs SDRe for each group of mice (Wilcoxon test with Holm–Šidák multiple comparisons correction. Scr p<0.0001; ShRNF10 p=0.0201; Sh+ShResistant p=0.1484). Values are expressed as means ± s.e.m. *p < 0.05, **p < 0.01, ***p < 0.001, ****p<0.0001.

Journal: bioRxiv

Article Title: Hippocampal Ring Finger Protein 10-dependent signaling supports cognitive flexibility

doi: 10.64898/2026.03.31.715507

Figure Lengend Snippet: ( A ) qRT-PCR analysis for the expression of endogenous RNF10 following injection with scramble shRNA (n=13), shRNF10 (n=13) or shRNF10 + ShResistant (n=10) in the mouse dCA1. Gene expression was normalized to TUBA1A (Brown–Forsythe ANOVA with Dunnett’s T3 multiple comparisons test. p≤0.0001). ( B ) Performance in the object location test 24 h following the sample phase for Scr (n = 14), ShRNF10 (n = 15) and ShRNF10 + ShResistant (n = 14) mice, expressed as the discrimination ratio (One-way ANOVA with Tukey’s post hoc test. Scr vs ShRNF10 p=0.0001; Scr vs Sh+ShResistant p=0.9078; ShRNF10 vs Sh+ShResistant p=0.0004) ( C ) Number of trials (Mixed-effects model with Fisher’s LSD multiple comparisons test. SD: Scr vs ShRNF10 p=0.5918; Scr vs Sh+ShResistant p=0.0656; ShRNF10 vs Sh+ShResistant p=0.1781; SDRe: Scr vs ShRNF10 p=0.0202; Scr vs Sh+ShResistant p=0.1125; ShRNF10 vs Sh+ShResistant p=0.7725) and ( D ) time (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance. SD: Scr vs ShRNF10 p=0.9953; Scr vs Sh+ShResistant p=0.0119; ShRNF10 vs Sh+ShResistant p=0.0130; SDRe: Scr vs ShRNF10 p=0.0456; Scr vs Sh+ShResistant p=0.2449; ShRNF10 vs Sh+ShResistant p=0.6527) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( E ) Latency to make a correct response (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance; SD: Scr vs ShRNF10 p=0.8420; Scr vs Sh+ShResistant p=0.1186; ShRNF10 vs Sh+ShResistant p=0.0855; SDRe: Scr vs ShRNF10 p=0.0543; Scr vs Sh+ShResistant p=0.7026; ShRNF10 vs Sh+ShResistant p=0.1701) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( F ) Number of perseverant and regressive errors made by Scr (n = 19), ShRNF10 (n = 18) and ShRNF10 + ShResistant (n = 13) mice during the SDRe (Kruskal–Wallis test with Dunn’s multiple comparisons test. Perseverant: Scr vs ShRNF10 p=0.0054; Scr vs Sh+ShResistant p>0.9999; ShRNF10 vs Sh+ShResistant p=0.0358; Regressive: Scr vs ShRNF10 p=0.0.6805; Scr vs Sh+ShResistant p=0.0016; ShRNF10 vs Sh+ShResistant p=0.0527). ( G ) Comparison of time required to complete the SD vs SDRe for each group of mice (Wilcoxon test with Holm–Šidák multiple comparisons correction. Scr p<0.0001; ShRNF10 p=0.0201; Sh+ShResistant p=0.1484). Values are expressed as means ± s.e.m. *p < 0.05, **p < 0.01, ***p < 0.001, ****p<0.0001.

Techniques: Quantitative RT-PCR, Expressing, Injection, shRNA, Gene Expression, Comparison

(A) Representative images showing dendrites of adult mice dCA1 neurons and protrusion densities (two-tailed unpaired t-test p = 0.7367, n = 37/35) after injecting either RNF10 shRNA or the scramble control (scr; scale bar = 5 μm). ( B ) Violin plots representing, for both conditions dendritic spine width (two-tailed unpaired t-test; p = 0.0002, n = 36/35), and ( C ) dendritic spine length (two-tailed unpaired t-test; p = 0.0006, n = 37,35). ( D ) Representative images showing dendrites of adult mice dCA1 neurons of adult RNF10 KO and WT mice (scale bar = 5 μm) and quantification of protrusion densities (two-tailed unpaired t-test, p = 0.1935, n = 13/16). ( E ) Bar graphs representing, for both conditions, dendritic spine width (two-tailed unpaired t-test, p = 0.0353, n = 13/16) and ( F ) dendritic spine length (two-tailed unpaired t-test, p = 0.0327, n = 13/16). ( G ) Total dendritic length (two-tailed unpaired t-test, p = 0.0033, n = 3) and ( H ) representative sketched neurons and quantification via Sholl analysis (two-tailed paired t-test, p < 0.0001) of CA1 hippocampal neurons from brain slices of adult RNF10 KO and WT mice. ( I ) Total dendritic length (two-tailed unpaired t-test, p = 0.5581, n = 3) and ( J ) representative sketched neurons and quantification via Sholl analysis (F; two-tailed paired t-test, p = 0.5810) of DG hippocampal neurons from brain slices of adult RNF10 KO and WT mice. *p < 0.01, **p < 0.005, ***p<0.001. Values are expressed as means ± s.e.m.

Journal: bioRxiv

Article Title: Hippocampal Ring Finger Protein 10-dependent signaling supports cognitive flexibility

doi: 10.64898/2026.03.31.715507

Figure Lengend Snippet: (A) Representative images showing dendrites of adult mice dCA1 neurons and protrusion densities (two-tailed unpaired t-test p = 0.7367, n = 37/35) after injecting either RNF10 shRNA or the scramble control (scr; scale bar = 5 μm). ( B ) Violin plots representing, for both conditions dendritic spine width (two-tailed unpaired t-test; p = 0.0002, n = 36/35), and ( C ) dendritic spine length (two-tailed unpaired t-test; p = 0.0006, n = 37,35). ( D ) Representative images showing dendrites of adult mice dCA1 neurons of adult RNF10 KO and WT mice (scale bar = 5 μm) and quantification of protrusion densities (two-tailed unpaired t-test, p = 0.1935, n = 13/16). ( E ) Bar graphs representing, for both conditions, dendritic spine width (two-tailed unpaired t-test, p = 0.0353, n = 13/16) and ( F ) dendritic spine length (two-tailed unpaired t-test, p = 0.0327, n = 13/16). ( G ) Total dendritic length (two-tailed unpaired t-test, p = 0.0033, n = 3) and ( H ) representative sketched neurons and quantification via Sholl analysis (two-tailed paired t-test, p < 0.0001) of CA1 hippocampal neurons from brain slices of adult RNF10 KO and WT mice. ( I ) Total dendritic length (two-tailed unpaired t-test, p = 0.5581, n = 3) and ( J ) representative sketched neurons and quantification via Sholl analysis (F; two-tailed paired t-test, p = 0.5810) of DG hippocampal neurons from brain slices of adult RNF10 KO and WT mice. *p < 0.01, **p < 0.005, ***p<0.001. Values are expressed as means ± s.e.m.

Techniques: Two Tailed Test, shRNA, Control

Review

Structured Review

Images

Similar Products

Image Search Results